View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-19 (Length: 138)
Name: Solexa-NF5887-19
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-19 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 4 - 138
Target Start/End: Complemental strand, 43466598 - 43466464
Alignment:
| Q |
4 |
cagagatcaatttctaaaccataatttgcagatccataaagcaattcaggagcccggaaccagtgagttccaacacatgatgtgagacaaccatgttctt |
103 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43466598 |
cagagatcaatttctaaaccataattagcagatccataaagcaattcaggagcccggaaccagcgagttccaacacatgatgtgagacaaccatgttctt |
43466499 |
T |
|
| Q |
104 |
tatcttccccctccattgcttcataactaaaagaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43466498 |
tatcttccccctccattgcttcataactaaaagaa |
43466464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 7 - 89
Target Start/End: Original strand, 33088240 - 33088322
Alignment:
| Q |
7 |
agatcaatttctaaaccataatttgcagatccataaagcaattcaggagcccggaaccagtgagttccaacacatgatgtgag |
89 |
Q |
| |
|
||||||| |||||||||||||| | ||||||||||| | |||||| |||| ||||| ||||||||||||||||||||| |
|
|
| T |
33088240 |
agatcaacctctaaaccataattagttgatccataaagtagttcaggtgccctaaaccatctagttccaacacatgatgtgag |
33088322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University