View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-21 (Length: 135)
Name: Solexa-NF5887-21
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 12 - 135
Target Start/End: Complemental strand, 7454559 - 7454436
Alignment:
| Q |
12 |
gaccatagaggtatttgatatgctaaggtgcgagtttgaacgtgcaattttttcgcttctcaagtgtgaattttgccgctaggctctttaaaatcacctt |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7454559 |
gaccataggggtatttgatatgctaaggtgcgagtttgaacgtgcaattttttcacttctcaagtgtgaattttgccgctaggctctttaaaatcacctt |
7454460 |
T |
 |
| Q |
112 |
ttctttttattaagatctaaaatg |
135 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7454459 |
ttctttttattaagatctaaaatg |
7454436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University