View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-29 (Length: 127)
Name: Solexa-NF5887-29
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 7 - 127
Target Start/End: Complemental strand, 46954926 - 46954806
Alignment:
| Q |
7 |
aagatatgtaactcatatacttaatgttttaaagttttagaaggagaggtggtcctggagtattgatccgtttctgctccagacaccccccaacaactat |
106 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46954926 |
aagatatgtaactcatatacttaacgttttaaagttttagaaggagaggtggtcctggagtattgatccgtttctgctccagacaccccccaacaactat |
46954827 |
T |
 |
| Q |
107 |
atagctctaaagccttcactc |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46954826 |
atagctctaaagccttcactc |
46954806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University