View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-34 (Length: 127)
Name: Solexa-NF5887-34
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 31167521 - 31167414
Alignment:
| Q |
8 |
tgtgtgacactaggcttgccattataatctgagaaatgaaatcatatatcatatactttaattactttgcatgactaatatgtataacaacatcaatgaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31167521 |
tgtgtgacactaggcttgccattataatctgagaaatgaaatcatatatcatatagtttaattactttgcatgactaatatgtataacaacatcaatgaa |
31167422 |
T |
|
| Q |
108 |
tatcaatt |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
31167421 |
tatcaatt |
31167414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University