View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-36 (Length: 126)
Name: Solexa-NF5887-36
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 7 - 115
Target Start/End: Complemental strand, 46413363 - 46413255
Alignment:
| Q |
7 |
agtagttgaccatgtcagacgaaaaagatgatgtaatcaagtggtacttgcctttccagcagagtaaattctttggcaaagagacagggttggacaagaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46413363 |
agtagttgaccatgtcagacgaaaaagatgatgtaatcaagtggtacttgcctttccagcagagtaaattctttggcaaagagacagggttggacaagaa |
46413264 |
T |
|
| Q |
107 |
aggaaggga |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
46413263 |
aggaaggga |
46413255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University