View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-38 (Length: 117)
Name: Solexa-NF5887-38
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-38 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 2e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 7 - 117
Target Start/End: Original strand, 14241341 - 14241451
Alignment:
| Q |
7 |
acctttagcccttcctaagtacacaccaccaatgccataaactttgcctttgacaaatataaatccactcatctcactttcattttctctatttgcagct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14241341 |
acctttagcccttcctaagtacacaccaccaatgccataaactttgcctttgacaaatataaatccactcatctcactttcattttctctatttgcagct |
14241440 |
T |
 |
| Q |
107 |
gtaattgaccc |
117 |
Q |
| |
|
||||||||||| |
|
|
| T |
14241441 |
gtaattgaccc |
14241451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 7 - 117
Target Start/End: Complemental strand, 12957612 - 12957502
Alignment:
| Q |
7 |
acctttagcccttcctaagtacacaccaccaatgccataaactttgcctttgacaaatataaatccactcatctcactttcattttctctatttgcagct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12957612 |
acctttagcccttcctaagtacacaccaccaatgccataaactttgcctttgataaatataaatccactcatctcactttcattttctctatttgcagct |
12957513 |
T |
 |
| Q |
107 |
gtaattgaccc |
117 |
Q |
| |
|
||||||||||| |
|
|
| T |
12957512 |
gtaattgaccc |
12957502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University