View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-39 (Length: 112)
Name: Solexa-NF5887-39
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-39 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 1e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 1e-50
Query Start/End: Original strand, 8 - 112
Target Start/End: Original strand, 4093291 - 4093395
Alignment:
| Q |
8 |
aaggcttagtggaaatagttatacatttgtatcacatttgcaccccttttgcattttacaaatactattctgtttatgtcacattttttcttagatgaaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4093291 |
aaggcttagtggaaatagttatacatttgtatcacatttgcaccccttttgcattttacaaatactattctgtttatgtcatattttttcttagatgaaa |
4093390 |
T |
|
| Q |
108 |
tcagt |
112 |
Q |
| |
|
||||| |
|
|
| T |
4093391 |
tcagt |
4093395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University