View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-6 (Length: 161)
Name: Solexa-NF5887-6
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 4 - 161
Target Start/End: Original strand, 6864542 - 6864699
Alignment:
| Q |
4 |
cataggccttagaaggaagatcggtgatggttctaaatcaatgtgtggagtatgccatggatccgtaaccttccttccctaaaaccatcttcaccaacat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
6864542 |
cataggccttagaaggaagatcggtgatggttctaaatcaatgtgtggagtatgccatggatccgtaacctttcttccctaaaaccgtcttcaccaacat |
6864641 |
T |
|
| Q |
104 |
tgcaaaactttgatgatcttacggttaattatttattgaattcgggcttgaagtcttg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6864642 |
tgcaaaactttgatgatcttacggttaattatttattgaattcgggcttgaattcttg |
6864699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 103 - 161
Target Start/End: Original strand, 33707641 - 33707699
Alignment:
| Q |
103 |
ttgcaaaactttgatgatcttacggttaattatttattgaattcgggcttgaagtcttg |
161 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| |||| ||| |||||||| ||||| |
|
|
| T |
33707641 |
ttgcaaaattttgaagatcttacggttaattatttgttgagttcaggcttgaattcttg |
33707699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 31801313 - 31801382
Alignment:
| Q |
8 |
ggccttagaaggaagatcggtgatggttctaa-atcaatgtgtggagtatgccatggatccgtaaccttc |
76 |
Q |
| |
|
|||| |||| ||||||| || ||||||||||| || ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
31801313 |
ggccatagatggaagattggagatggttctaagattaatgtgtggagtatgccgtggatccgcaaccttc |
31801382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 46598630 - 46598699
Alignment:
| Q |
8 |
ggccttagaaggaagatcggtgatggttctaa-atcaatgtgtggagtatgccatggatccgtaaccttc |
76 |
Q |
| |
|
|||| |||| ||||||| || ||||||||||| || ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
46598630 |
ggccatagatggaagattggagatggttctaagattaatgtgtggagtatgccgtggatccgcaaccttc |
46598699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 29 - 92
Target Start/End: Original strand, 512704 - 512768
Alignment:
| Q |
29 |
gatggttctaa-atcaatgtgtggagtatgccatggatccgtaaccttccttccctaaaaccatc |
92 |
Q |
| |
|
||||||||||| || |||||||||||||| || |||||||| |||||||| || || |||||||| |
|
|
| T |
512704 |
gatggttctaagattaatgtgtggagtattccgtggatccgcaaccttccctctctcaaaccatc |
512768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University