View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-7 (Length: 160)
Name: Solexa-NF5887-7
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-7 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 4e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 16 - 160
Target Start/End: Complemental strand, 14242069 - 14241925
Alignment:
| Q |
16 |
gttatatattcatgagaggaaatggaagaggaaaaactgcaattgtgtggtccgaaagctcctctaacaacatagcttctgccaccttcaaagttgaagc |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14242069 |
gttatacattcatgagaggaaatggaagaggaaaaactgcaattgtttggtccgaaagctcctctaacaacatagcttctgccaccttcaaagttgaagc |
14241970 |
T |
 |
| Q |
116 |
ctcggatttcattgcctttggaattagcttcaaggtattgtcata |
160 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14241969 |
cttggatttcattgcctttggaattagcttcaaggtattttcata |
14241925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 4e-55
Query Start/End: Original strand, 16 - 152
Target Start/End: Original strand, 12956530 - 12956666
Alignment:
| Q |
16 |
gttatatattcatgagaggaaatggaagaggaaaaactgcaattgtgtggtccgaaagctcctctaacaacatagcttctgccaccttcaaagttgaagc |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12956530 |
gttatatatttatgagaggaaatggaagaggaaaaactgccattgtttggtctgaaagctcctctgacaacatagcttctgccaccttcaaagttgaagc |
12956629 |
T |
 |
| Q |
116 |
ctcggatttcattgcctttggaattagcttcaaggta |
152 |
Q |
| |
|
| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
12956630 |
ccccgatttcattgcctttggaattagcttcaaggta |
12956666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University