View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-9 (Length: 146)
Name: Solexa-NF5887-9
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-9 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 4e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 57 - 146
Target Start/End: Complemental strand, 7454294 - 7454205
Alignment:
| Q |
57 |
acatacattaaataacacatggttgtcaaaaattcattactgtacgtagcttgataatgtagtatatcacatggttggatatttcttccc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7454294 |
acatacattaaataacacatggttgtcaaaaattcgttacggtacgtagcttgataatgtagtatatcacatggttggatatttcttccc |
7454205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 7454385 - 7454353
Alignment:
| Q |
6 |
tatgaatgctctaatattatgcagatacaaatg |
38 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
7454385 |
tatgaatgctataatattatgcagatacaaatg |
7454353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University