View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5888-1 (Length: 169)
Name: Solexa-NF5888-1
Description: NF5888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5888-1 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 8 - 169
Target Start/End: Complemental strand, 9397157 - 9396996
Alignment:
| Q |
8 |
acttcttcttaaatctcaccatgcaaaaattattattaacatgaacttgtggagatgctagttgttgatagaatctaaaatcatgatcattctgacatta |
107 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9397157 |
acttcttcttgaagctcaccatgcaaaaattattattaacatgaacttgtggagatgctagttgttgatagaatctaaaatcatgatcattctgacatta |
9397058 |
T |
 |
| Q |
108 |
gttaacttagcgattgaggaaaatgtgtcataatagtataacctttctatttgattgtaacc |
169 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9397057 |
gttaacttcgcgattgaggaaaatgtgtcataatagtataacctttctatttgattgtaacc |
9396996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University