View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5888-2 (Length: 132)
Name: Solexa-NF5888-2
Description: NF5888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5888-2 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 3 - 132
Target Start/End: Complemental strand, 38001130 - 38001001
Alignment:
| Q |
3 |
gatgaatatggattgacatctcatcatggcaagaactagttggtgcaggccccattcgaattgcagaaggtgaagtttggtgattgttacaatttaccaa |
102 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38001130 |
gatgaatatggattgacatcttatcatggcaagaactagttggttcaggccccattcgaattgcagaaggtgaagtttggtgattgttacaatttaccaa |
38001031 |
T |
|
| Q |
103 |
atgaattacctcatttggaataccaaatat |
132 |
Q |
| |
|
||||||||||||| |||||||||||||||| |
|
|
| T |
38001030 |
atgaattacctcagttggaataccaaatat |
38001001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University