View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5888-3 (Length: 129)
Name: Solexa-NF5888-3
Description: NF5888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5888-3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 2e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 44098707 - 44098638
Alignment:
| Q |
1 |
gatcccttcctcttctttgatgttctat-ccattcaatccttcatcaattcatcttcaaattgaaattct |
69 |
Q |
| |
|
||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44098707 |
gatcccttcctcttctttgttgttctgttccattcaatccttcatcaattcatcttcaaattgaaattct |
44098638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 23046995 - 23047064
Alignment:
| Q |
1 |
gatcccttcctcttctttgatgttctat-ccattcaatccttcatcaattcatcttcaaattgaaattct |
69 |
Q |
| |
|
||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23046995 |
gatcccttcctcttctttgctgttcttttccattcaatccttcatcaattcatcttcaaattaaaattct |
23047064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 7e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 7e-19
Query Start/End: Original strand, 66 - 129
Target Start/End: Complemental strand, 34900644 - 34900581
Alignment:
| Q |
66 |
ttctctattgaaggtggattgtagtccaatgttgttcagattctgaattgtttgttcattgttg |
129 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34900644 |
ttctctattgaaggtggattagaatccaatgttgttcagattttgaattgtttgttcattgttg |
34900581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.0000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 31 - 67
Target Start/End: Complemental strand, 45517651 - 45517615
Alignment:
| Q |
31 |
attcaatccttcatcaattcatcttcaaattgaaatt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45517651 |
attcaatccttcatcaattcatcttcaaatcgaaatt |
45517615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University