View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-11 (Length: 147)
Name: Solexa-NF5889-11
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 44729670 - 44729528
Alignment:
| Q |
1 |
gtgaaagttgttggtttaagttggttttaattgttagttatgttatattggcacttctgnnnnnnnnncttcactttcttctctgtatatctctaatgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44729670 |
gtgaaagttgttggtttaagttggttttaattgttagttatgttatattggcacttctgtttttt----ttcactttcttctctgtatatctctaatgag |
44729575 |
T |
|
| Q |
101 |
ccacagcttaatttactcacttgtgacaacactatttctacttctct |
147 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44729574 |
ccacagcttaatttaatcacttgtgacaacactatttctacttctct |
44729528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University