View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5889-14 (Length: 142)

Name: Solexa-NF5889-14
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5889-14
Solexa-NF5889-14
[»] chr7 (2 HSPs)
chr7 (55-142)||(47828775-47828862)
chr7 (2-56)||(47828885-47828939)


Alignment Details
Target: chr7 (Bit Score: 80; Significance: 7e-38; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 7e-38
Query Start/End: Original strand, 55 - 142
Target Start/End: Complemental strand, 47828862 - 47828775
Alignment:
55 aattattagtaacaatgcagagtgtgacagacaagaccttgatgatcccattggcatgataaggatgccatattcttctaagtccttg 142  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||    
47828862 aattattagtaacaatgcagagtgtgacagacaagaccttgatgttcccattggcatgataagtatgccatattcttctaagtccttg 47828775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 2 - 56
Target Start/End: Complemental strand, 47828939 - 47828885
Alignment:
2 atgaaccaatgaaatttgatacgatacgattcatatgaataaattactttaataa 56  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
47828939 atgaaccaatgaaatttgatacgataagattcatatgaataaattactttaataa 47828885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University