View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-14 (Length: 142)
Name: Solexa-NF5889-14
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-14 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 7e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 7e-38
Query Start/End: Original strand, 55 - 142
Target Start/End: Complemental strand, 47828862 - 47828775
Alignment:
| Q |
55 |
aattattagtaacaatgcagagtgtgacagacaagaccttgatgatcccattggcatgataaggatgccatattcttctaagtccttg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47828862 |
aattattagtaacaatgcagagtgtgacagacaagaccttgatgttcccattggcatgataagtatgccatattcttctaagtccttg |
47828775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 2 - 56
Target Start/End: Complemental strand, 47828939 - 47828885
Alignment:
| Q |
2 |
atgaaccaatgaaatttgatacgatacgattcatatgaataaattactttaataa |
56 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47828939 |
atgaaccaatgaaatttgatacgataagattcatatgaataaattactttaataa |
47828885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University