View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-17 (Length: 139)
Name: Solexa-NF5889-17
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-17 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 4e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 4e-73
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 17670778 - 17670916
Alignment:
| Q |
1 |
agaacaattcacagttgaagaatgcagaaaatgcaaatgatcatctgaatgatgacaggccagttatgcattcagagaatggtaatcactcagatggtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17670778 |
agaacaattcacagttgaagaatgcagaaaatgcaaatgatcatctgaatgatgacaggccagttatgcattcagagaatggtaatcactcagatggtac |
17670877 |
T |
|
| Q |
101 |
aagtctgagtttgtggatgccacacaaattgaagacaat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17670878 |
aagtctgagtttgtggatgccacacaaattgaagacaat |
17670916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 5 - 139
Target Start/End: Complemental strand, 14673268 - 14673134
Alignment:
| Q |
5 |
caattcacagttgaagaatgcagaaaatgcaaatgatcatctgaatgatgacaggccagttatgcattcagagaatggtaatcactcagatggtacaagt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14673268 |
caattcacagttgaagaatgcagaaaatgcaaatgatcatctgaatgatgacaggccagttatgcattcagagaatggtaatcactcagatggtacaagt |
14673169 |
T |
|
| Q |
105 |
ctgagtttgtggatgccacacaaattgaagacaat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14673168 |
ctgagtttgtggatgccacacaaattgaagacaat |
14673134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University