View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-18 (Length: 139)
Name: Solexa-NF5889-18
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-18 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 2e-68
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 47068364 - 47068226
Alignment:
| Q |
1 |
atgaaaaccttctcagagccacctcttcattcaaccctaggttcccagtgtccattagccttttgtaccttaatacccgaatcttgtaaacgtaatggat |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47068364 |
atgaaaaccttctcagagtcacctcttcattcaaccctaggttcccagtgtccgttagccttttgtaccttaatacccgaatcttgtaaacgtaatggat |
47068265 |
T |
 |
| Q |
101 |
ggatattaaaatcgctgaacacaaaagcgcagtaaaaat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47068264 |
ggatattaaaatcgctgaacacaaaagcgcagtaaaaat |
47068226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 55 - 106
Target Start/End: Original strand, 47076023 - 47076074
Alignment:
| Q |
55 |
ttagccttttgtaccttaatacccgaatcttgtaaacgtaatggatggatat |
106 |
Q |
| |
|
|||||||||| ||| ||||||||||||| ||||| | ||||||||||||||| |
|
|
| T |
47076023 |
ttagccttttatactttaatacccgaattttgtacatgtaatggatggatat |
47076074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University