View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-19 (Length: 137)
Name: Solexa-NF5889-19
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-19 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 9e-68; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 9e-68
Query Start/End: Original strand, 8 - 137
Target Start/End: Complemental strand, 42211083 - 42210954
Alignment:
| Q |
8 |
aacaagctgtcagggaacattcctaaaatcgaagttaacggattgaaaacacttatgatggcaagaaacaattttagtggctcaattccaaatagtctag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42211083 |
aacaagctgtcagggaacattcctaaaatcgaagttaacggattgaaaacacttatgatggcaagaaacaattttagtggctcaattccaaatagtctag |
42210984 |
T |
|
| Q |
108 |
gggatttgccatcccttgtgactttagatc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42210983 |
gggatttgccatcccttgtgactttagatc |
42210954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 102; E-Value: 5e-51
Query Start/End: Original strand, 8 - 137
Target Start/End: Complemental strand, 42223299 - 42223170
Alignment:
| Q |
8 |
aacaagctgtcagggaacattcctaaaatcgaagttaacggattgaaaacacttatgatggcaagaaacaattttagtggctcaattccaaatagtctag |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42223299 |
aacatgctgtcagggaacattcctaaaatcgaagttgacggattgaaaacactagtgatggcaagaaacaattttagtggctcaattccaaatagtctag |
42223200 |
T |
|
| Q |
108 |
gggatttgccatcccttgtgactttagatc |
137 |
Q |
| |
|
| ||||| ||||||||||||||||||||| |
|
|
| T |
42223199 |
gtgatttagcatcccttgtgactttagatc |
42223170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 15 - 137
Target Start/End: Complemental strand, 42198505 - 42198379
Alignment:
| Q |
15 |
tgtcagggaacattcctaaaatcgaagt---taa-cggattgaaaacacttatgatggcaagaaacaattttagtggctcaattccaaatagtctagggg |
110 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||| ||||||||||| |||| ||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42198505 |
tgtcagggaacattcctaaattagaagtaattaagcggattgaaaatacttgtgatggctagaaacaaatttagtggctcaattccaaatagtctagggg |
42198406 |
T |
|
| Q |
111 |
atttgccatcccttgtgactttagatc |
137 |
Q |
| |
|
|||| |||| ||||||||||| |||| |
|
|
| T |
42198405 |
atttagcatcacttgtgactttggatc |
42198379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University