View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-21 (Length: 132)
Name: Solexa-NF5889-21
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 5 - 132
Target Start/End: Complemental strand, 6113559 - 6113432
Alignment:
| Q |
5 |
gaacaagaactatgtggacacttaattcaatctatgcatgatgtcaagaatacaaatttgcactataggtaacaaaagggttgtattattagaaattaga |
104 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6113559 |
gaacaagaactatgtggacaattaattcaatctatgcatgatgtcaagaatacaagtttgcactataggtaacacaagggttgtattattagaaattaga |
6113460 |
T |
 |
| Q |
105 |
ttatgtaataatttcattctaacttcag |
132 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
6113459 |
ttatgtaataatttcattctaccttcag |
6113432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University