View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-26 (Length: 127)
Name: Solexa-NF5889-26
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-26 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 5e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 5e-29
Query Start/End: Original strand, 47 - 127
Target Start/End: Original strand, 7881304 - 7881384
Alignment:
| Q |
47 |
caaaagagcaggatttagacaattctaatatccttgcgccgttggagtcatgtttgtgccataaacctctcttgaatcaac |
127 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7881304 |
caaaagagcaggatttagacaattataatatccttgcgcggtcggagtcatgtttgtgccataaacctctcttgagtcaac |
7881384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 10 - 46
Target Start/End: Original strand, 7881248 - 7881284
Alignment:
| Q |
10 |
caggatcttcttctctttaatcaactaattgttctga |
46 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7881248 |
caggatcttcttctcttgaatcaactaattgttctga |
7881284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University