View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-28 (Length: 127)
Name: Solexa-NF5889-28
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-28 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 9 - 127
Target Start/End: Original strand, 47828662 - 47828780
Alignment:
| Q |
9 |
acaacaattgcattattatttctctgattacttatgtgtttaatcaataatctctgataacagatatatattgaaattgaagagaattcaggaacaacag |
108 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47828662 |
acaacaattgcattattgtttctctgattacttatgtgtttaatcaataatctctgataacagatatatattgaaattgaagagaattcaggaaccacag |
47828761 |
T |
|
| Q |
109 |
cagcaaagctatccaagga |
127 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47828762 |
cagcaaagctatccaagga |
47828780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University