View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-31 (Length: 125)
Name: Solexa-NF5889-31
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-31 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 3e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 47067721 - 47067838
Alignment:
| Q |
8 |
tgaagtaaaggggttttgtagcttaaacagttactgcacattcaaggatgataaaccattatgcaactgtctcacgggttataaatttatagatgcaaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47067721 |
tgaagtaaaggggttttgtagcttaaacagttactgcacattcaaggatgataaaccattatgcaactgtctcacgggttataaatttatagatgcaaat |
47067820 |
T |
 |
| Q |
108 |
gaaaagactctctgctgc |
125 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
47067821 |
gaaaagactctcggctgc |
47067838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 12 - 110
Target Start/End: Complemental strand, 47076602 - 47076504
Alignment:
| Q |
12 |
gtaaaggggttttgtagcttaaacagttactgcacattcaaggatgataaaccattatgcaactgtctcacgggttataaatttatagatgcaaatgaa |
110 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||||||| | || || |||||| ||||||| |||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
47076602 |
gtaaaggggttttgtggctacaacagtttctgcacattcgatgacgacaaaccagtatgcaattgtctcccgggttataaacttatagatgcaaatgaa |
47076504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University