View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-34 (Length: 122)
Name: Solexa-NF5889-34
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-34 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 4 - 122
Target Start/End: Complemental strand, 4821693 - 4821575
Alignment:
| Q |
4 |
aacagagaagagatgagatgatattttagaggggaaagattgggactttaaatttagttgattgtgtcctttttatagattagtgtaaattatgttaaag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4821693 |
aacagagaagagatgagatgatattttagaggggaaagattgggactttaaatttagttgattgtgtcctttttatagattagtgtaaattatgacaaag |
4821594 |
T |
 |
| Q |
104 |
ttggaggcactcgtttttg |
122 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4821593 |
ttggaggcactcgtttttg |
4821575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University