View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-37 (Length: 119)
Name: Solexa-NF5889-37
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-37 |
 | |
|
| [»] chr1 (6 HSPs) |
| |
|
| [»] scaffold0312 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 1e-54; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 967330 - 967441
Alignment:
| Q |
8 |
attccatctcaattagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattactt |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
967330 |
attccatctcaactagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattactt |
967429 |
T |
|
| Q |
108 |
ttctcatggtga |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
967430 |
ttctcatggtga |
967441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 947346 - 947457
Alignment:
| Q |
8 |
attccatctcaattagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattactt |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
947346 |
attccatctcaactagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattactt |
947445 |
T |
|
| Q |
108 |
ttctcatggtga |
119 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
947446 |
ttcttatggtga |
947457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 959325 - 959436
Alignment:
| Q |
8 |
attccatctcaattagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattactt |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
959325 |
attccatctcaactagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctctttcacatcattactt |
959424 |
T |
|
| Q |
108 |
ttctcatggtga |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
959425 |
ttctcatggtga |
959436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 51 - 119
Target Start/End: Original strand, 974000 - 974068
Alignment:
| Q |
51 |
tagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattacttttctcatggtga |
119 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| ||||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
974000 |
tagagtttcagcttcatttatccaatatggattttcatcttgttcacatcattacttttttcatggtga |
974068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 51 - 119
Target Start/End: Complemental strand, 421023 - 420955
Alignment:
| Q |
51 |
tagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattacttttctcatggtga |
119 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| ||||||||| |||| | |||||||||| ||||||||| |
|
|
| T |
421023 |
tagagtttcagcttcactaatccaatatggattttcatcttgttcacaccattacttttttcatggtga |
420955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 52 - 119
Target Start/End: Original strand, 940959 - 941026
Alignment:
| Q |
52 |
agagtttcagcttcacttatccaacatggaatttcatctttttcatatcattacttttctcatggtga |
119 |
Q |
| |
|
||||||||||||||||| |||||| ||||| || ||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
940959 |
agagtttcagcttcactaatccaatatggagttccatctctttcacatcattacttctctcatggtga |
941026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0312 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0312
Description:
Target: scaffold0312; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 51 - 119
Target Start/End: Original strand, 9548 - 9616
Alignment:
| Q |
51 |
tagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattacttttctcatggtga |
119 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| ||||||||| |||| | |||||||||| ||||||||| |
|
|
| T |
9548 |
tagagtttcagcttcactaatccaatatggattttcatcttgttcacaccattacttttttcatggtga |
9616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University