View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-39 (Length: 114)
Name: Solexa-NF5889-39
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-39 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 1e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 9080028 - 9079922
Alignment:
| Q |
8 |
attcaatcattctatatatcatacaatatttcatctaaaatctctttttccatcctcattagtcattaccttaaaacactatcttaaacatatacgagaa |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9080028 |
attcaatcattcaatatatcatacaatatttcatctaatatctctttttccatcctcattcgtcattaccttaaaacactatcttaaacatataggagaa |
9079929 |
T |
 |
| Q |
108 |
atgatat |
114 |
Q |
| |
|
||||||| |
|
|
| T |
9079928 |
atgatat |
9079922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 9088720 - 9088631
Alignment:
| Q |
12 |
aatcattctatatatcatacaatatttcatctaaaatctctttttccatcctcattagtcattaccttaaaacactatcttaaacatatac |
102 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | ||||||| || ||||||||| |||| |||||||||||||||||||| ||| |||| |
|
|
| T |
9088720 |
aatcattctatatatcatactatatttcatctata-tctctttctctatcctcattcgtcactaccttaaaacactatcttatacacatac |
9088631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University