View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-40 (Length: 112)
Name: Solexa-NF5889-40
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-40 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 8e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 8e-43
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 18442562 - 18442451
Alignment:
| Q |
1 |
gagagtataggttggtcgaacatacttcatacaaagataccgacactctttgttagtcttaaactgtgtgatggcaaattggttttgtgaaggacatctg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
18442562 |
gagagtataggttggtcgaacatgcttcatacaaagataccgactatctttgttagtcttaaactgtgtgatggtaaattggttctgtgaaggtcatctg |
18442463 |
T |
|
| Q |
101 |
ctactctagttc |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
18442462 |
ctactctagttc |
18442451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University