View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-41 (Length: 108)
Name: Solexa-NF5889-41
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-41 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 3e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 5 - 108
Target Start/End: Original strand, 15753390 - 15753493
Alignment:
| Q |
5 |
ttaagcaccaaataatgagcccgattaatgggtataataatcacatattacaacattaatatttgaattatgtttatgttgtatcgcagtggttgtgttg |
104 |
Q |
| |
|
||||||||||||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15753390 |
ttaagcaccaaataatgagtccggttaatgtgtataataatcacatattacaacattaatatttgaattatgtttatgttgtatcgcagtggttgtgttg |
15753489 |
T |
|
| Q |
105 |
attt |
108 |
Q |
| |
|
|||| |
|
|
| T |
15753490 |
attt |
15753493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University