View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-48 (Length: 72)
Name: Solexa-NF5889-48
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 8e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 8e-25
Query Start/End: Original strand, 2 - 68
Target Start/End: Original strand, 20378194 - 20378260
Alignment:
| Q |
2 |
gggaagtgatggagagtggctaggaggttacgsgaagagaattgagaagtgtagtgcatacatggca |
68 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
20378194 |
gggaagtgatggagagtggctaggaggtttcacgaagagaattgagaagtgtagtgcatacatggca |
20378260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.0000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 4568910 - 4568843
Alignment:
| Q |
1 |
ggggaagtgatggagagtggctaggaggttacgsgaagagaattgagaagtgtagtgcatacatggca |
68 |
Q |
| |
|
|||||||||||||||| ||| | ||||||| || ||||||||||| ||||||||| || ||||||||| |
|
|
| T |
4568910 |
ggggaagtgatggagaatggttgggaggtttcgcgaagagaattgggaagtgtagcgcttacatggca |
4568843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University