View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-5 (Length: 204)
Name: Solexa-NF5889-5
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 576293 - 576090
Alignment:
| Q |
1 |
gatcagggagaacaagtggttccttaactgtataaagttcaaggtttaattcttcaatattagggttaacaaaaatacttagccatttattaaccctagg |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
576293 |
gatcagagagaacaagtggttccttaactgtataaagttcaagctttaattcttcaatattagggttaacaaaaatacttagccatttagtaaccctagg |
576194 |
T |
 |
| Q |
101 |
tgcttccataccaacttcaaaaaatagagaaaacttttttaggcttgaagtattacaaaactgaagcaacttctctacaaagtctatgaattgttgcctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
576193 |
tgcttccataccaacttcaaaaaatagagaaaacttttttaggcttgaagtattacaaaacacacgcaacttctctacaaagtctatgaattgttgcctc |
576094 |
T |
 |
| Q |
201 |
tttt |
204 |
Q |
| |
|
|||| |
|
|
| T |
576093 |
tttt |
576090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University