View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5889-6 (Length: 195)
Name: Solexa-NF5889-6
Description: NF5889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5889-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 30484125 - 30484319
Alignment:
| Q |
1 |
ctgcttctgatactcctccgaccgcgagtgtgtccttgtccatttggtgtgcctttccatccaagtaatcttccttctttcctgctgttagatgtagtgc |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30484125 |
ctgcttctgatactcctccgaccacgagtgtgtccttgtccgtttggtgtgcctttccatccaagtaatcttccttctttcctgctgttagatgtagtgc |
30484224 |
T |
|
| Q |
101 |
tcctctttttggaagtggatctcaaactagtaactattccttgtgatctttggccacgagactggctgcggccttgtcgagtcctttgtcctttg |
195 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
30484225 |
tcctctttttggaattggatctcgaactagtaactattccttgtgatctttgaccacgagaatggctgcagccttgtcgagtcctttgtcctttg |
30484319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 12346354 - 12346278
Alignment:
| Q |
1 |
ctgcttctgatactcctccgaccgcgagtgtgtccttgtccatttggtgtgcctttccatccaagtaatcttccttc |
77 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12346354 |
ctgcttctgatacttctccgaccacgagtgtgtccttgtctgtttggtgtgcctttccatccaagaaatcttccttc |
12346278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University