View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk366-LTR4-TNT-insertion-2 (Length: 214)
Name: Tnk366-LTR4-TNT-insertion-2
Description: Tnk366-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk366-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 111
Target Start/End: Complemental strand, 19690872 - 19690800
Alignment:
| Q |
39 |
agttgtgcgctgccccagtcttacctcttcctaattttgaaaaggtgttccaagtggaatgtgatgatagtgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19690872 |
agttgtgcgctgccccagtcttacctcttcctaattttgaaaaggtgttccaagtggaatgtgatgatagtgg |
19690800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 39 - 111
Target Start/End: Original strand, 3540304 - 3540376
Alignment:
| Q |
39 |
agttgtgcgctgccccagtcttacctcttcctaattttgaaaaggtgttccaagtggaatgtgatgatagtgg |
111 |
Q |
| |
|
|||||||| | |||||||||||| |||||||| |||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
3540304 |
agttgtgcaccgccccagtcttagctcttcctgattttgaaaaggtgttccaagttgaatgtgatgctagtgg |
3540376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 39 - 111
Target Start/End: Complemental strand, 22923873 - 22923801
Alignment:
| Q |
39 |
agttgtgcgctgccccagtcttacctcttcctaattttgaaaaggtgttccaagtggaatgtgatgatagtgg |
111 |
Q |
| |
|
|||||||| | |||| ||||||| |||||||| |||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
22923873 |
agttgtgcaccgccctagtcttagctcttcctgattttgaaaaggtgttccaagttgaatgtgatgctagtgg |
22923801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 42
Target Start/End: Complemental strand, 2398471 - 2398441
Alignment:
| Q |
12 |
ccaagcttttgtggaagaaaaccagtgagtt |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2398471 |
ccaagcttttgtggaagaaaaccagtgagtt |
2398441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University