View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk366-LTR4-TNT-insertion-7 (Length: 320)
Name: Tnk366-LTR4-TNT-insertion-7
Description: Tnk366-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk366-LTR4-TNT-insertion-7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 51 - 198
Target Start/End: Complemental strand, 8922658 - 8922511
Alignment:
| Q |
51 |
taaagagattgttgagggaatgataggttatgttcatcttccagctatcatgtccaaactcttgagtgataatggtagtcaagaatttggctattttaaa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8922658 |
taaagagattgttgagggaatgataggttatgttcatcttccagctatcatgtccaaactcttgagtgataatggtagtcaagaatttggctattttaaa |
8922559 |
T |
 |
| Q |
151 |
cttaccatattggggatgcttggaacgtatggctttgaaagaagaatt |
198 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8922558 |
cttactatattggggatgcttggaacgtatggctttgaaagaagaatt |
8922511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 12 - 58
Target Start/End: Complemental strand, 2398471 - 2398425
Alignment:
| Q |
12 |
ccaagcttttgtggaagaaaaccagtgagtttgttatcataaagaga |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2398471 |
ccaagcttttgtggaagaaaaccagtgagtttgttatcataaagaga |
2398425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University