View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk387-LTR4-TNT-insertion-5 (Length: 338)
Name: Tnk387-LTR4-TNT-insertion-5
Description: Tnk387-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk387-LTR4-TNT-insertion-5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 7 - 328
Target Start/End: Original strand, 2413109 - 2413430
Alignment:
| Q |
7 |
accttttgtgcagtcctcaacaaaagcttagaataagttggatcaacttttctaaaaacaatagacgccgcagcaagtgcagcagcggtttcagcggcaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2413109 |
accttttgtgcagtcctcaacaaaagcttagaataagttggatcaacttttctaaaaacaatagacgccgcagcaagtgcagcagcggtttcagcggcaa |
2413208 |
T |
 |
| Q |
107 |
catcagaaccaggattctttgaagatacgtaataaacagttctaacagtgtccatatcttctggtctttcccaacatttgtgatcaacatttggatctcc |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2413209 |
catcagaaccgggattctttgaagatacgaaataaacagttctaacagtgtccatatcttctggtctttcccaacatttgtgatcaacatttggatctcc |
2413308 |
T |
 |
| Q |
207 |
aacaccaacatagagtcttccaggtgttgatgttgcacatttgaggagataatctgtcgcgtggcgaattgcagctcttgcttctttcatttgtggtccc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2413309 |
aacaccaacatagagtcttccaggtgttgatgttgcacatttgaggagataatctgtcgcgtggcgaattgcagctcttgcttctttcatttgtggtccc |
2413408 |
T |
 |
| Q |
307 |
atcctctttccatattcaattg |
328 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
2413409 |
attctctttccatattcaattg |
2413430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University