View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk442-LTR4-TNT-insertion-12 (Length: 154)
Name: Tnk442-LTR4-TNT-insertion-12
Description: Tnk442-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk442-LTR4-TNT-insertion-12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 7 - 146
Target Start/End: Original strand, 3846094 - 3846233
Alignment:
| Q |
7 |
acaaataagcatcaaaatcacttttttataatccctaacaaatgggtttctcttaccgtcttgcaatttctcaacaacgaaacataaaatacaaaaacca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3846094 |
acaaataagcatcaaaatcacttttttataatccctaacaaatgggtttctcttaccgtctcgcaatttctcaacaacgaaacataaaatacaaaaacca |
3846193 |
T |
|
| Q |
107 |
tcaaaagggttgctaggttaccttggaacgaatataatta |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3846194 |
tcaaaagggttgctaggttaccttggaacgaatataatta |
3846233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 17 - 54
Target Start/End: Original strand, 306677 - 306714
Alignment:
| Q |
17 |
atcaaaatcacttttttataatccctaacaaatgggtt |
54 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
306677 |
atcaaaatcaattttttataatccgtaacaaatgggtt |
306714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 17 - 48
Target Start/End: Complemental strand, 13851037 - 13851006
Alignment:
| Q |
17 |
atcaaaatcacttttttataatccctaacaaa |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
13851037 |
atcaaaatcacttttttataatccgtaacaaa |
13851006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University