View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk442-LTR4-TNT-insertion-15 (Length: 130)
Name: Tnk442-LTR4-TNT-insertion-15
Description: Tnk442-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk442-LTR4-TNT-insertion-15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 2e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 8 - 121
Target Start/End: Original strand, 49276859 - 49276974
Alignment:
| Q |
8 |
agactctcaagacttagggctttcgataccaaggtcttcagaaacaaggcaggttccatttatagccgactaaa--ttttttatcacgggccacatccag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49276859 |
agactctcaagacttagggctttcgataccaaggtcttcagaaacaacgcaggttccatttatagccgactaaattttttttatcacgggccacatccag |
49276958 |
T |
|
| Q |
106 |
aatattagctttatta |
121 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49276959 |
aatattagctttatta |
49276974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 58 - 104
Target Start/End: Original strand, 49280455 - 49280501
Alignment:
| Q |
58 |
aggttccatttatagccgactaaattttttatcacgggccacatcca |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
49280455 |
aggttccatttatagccgaataaattttttattatgggccacatcca |
49280501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University