View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk443-LTR4-TNT-insertion-9 (Length: 246)
Name: Tnk443-LTR4-TNT-insertion-9
Description: Tnk443-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk443-LTR4-TNT-insertion-9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 8 - 158
Target Start/End: Complemental strand, 1739973 - 1739823
Alignment:
| Q |
8 |
gatagctcaagatccaaatccacctaagccttttgttgggggagctttggcagcacttgacaatgctttcacatgggcatagtaagtctttgagatgtat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1739973 |
gatagctcaagatccaaatccacctaagccttttgttgggggagctttggcagcacttgacaatgctttcacatgggcatagtaagtctttgagatgtat |
1739874 |
T |
|
| Q |
108 |
ttaaattttaaattgtaacacataacatgtaacgtgccctttagtgcaaca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1739873 |
ttaaattttaaattgtaacacataacatgtaacgtgccctttagtgcaaca |
1739823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 8 - 129
Target Start/End: Complemental strand, 1718635 - 1718514
Alignment:
| Q |
8 |
gatagctcaagatccaaatccacctaagccttttgttgggggagctttggcagcacttgacaatgctttcacatgggcatagtaagtctttgagatgtat |
107 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1718635 |
gatagcccaagatccaaacccacctaagcctttcgttgggggagctttggcagcacttgacaatgctttcacatgggcatagtaagtctttgagatgtat |
1718536 |
T |
|
| Q |
108 |
ttaaattttaaattgtaacaca |
129 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1718535 |
ttaaattttaaattgtaacaca |
1718514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 102
Target Start/End: Complemental strand, 1755410 - 1755316
Alignment:
| Q |
8 |
gatagctcaagatccaaatccacctaagccttttgttgggggagctttggcagcacttgacaatgctttcacatgggcatagtaagtctttgaga |
102 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||| | ||||||||| | ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1755410 |
gatagctcaagatccaaacccacctaagccttttgttggaggatcattggcagcattagacaatgctttcacatgggcacagtaagtctttgaga |
1755316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 1750336 - 1750257
Alignment:
| Q |
18 |
gatccaaatccacctaagccttttgttgggggagctttggcagcacttgacaatgctttcacatgggcatagtaagtctt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | ||||| ||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
1750336 |
gatccaaatccacctaagccttttgttggaggatccttggctgcacttgacaatgcttttacatgggcacagtaagtctt |
1750257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 236
Target Start/End: Complemental strand, 1739775 - 1739745
Alignment:
| Q |
206 |
aataaaattgggttagagagaatttttatta |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1739775 |
aataaaattgggttagagagaatttttatta |
1739745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University