View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk444-LTR4-TNT-insertion-14 (Length: 70)
Name: Tnk444-LTR4-TNT-insertion-14
Description: Tnk444-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk444-LTR4-TNT-insertion-14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 56; Significance: 6e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 6e-24
Query Start/End: Original strand, 7 - 62
Target Start/End: Original strand, 40861844 - 40861899
Alignment:
| Q |
7 |
aaaaattagccacgttcatctttctaaaaacttgtacaccaagtttgctcacatta |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40861844 |
aaaaattagccacgttcatctttctaaaaacttgtacaccaagtttgctcacatta |
40861899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University