View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk444-LTR4-TNT-insertion-15 (Length: 437)
Name: Tnk444-LTR4-TNT-insertion-15
Description: Tnk444-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk444-LTR4-TNT-insertion-15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 223 - 428
Target Start/End: Original strand, 43294803 - 43295008
Alignment:
| Q |
223 |
caagtatgatactcaaaagcaaaattagtagtttttgtcttttaccacaaaaaagataggagtttaattttctctaacaaccattgtaactttgcttcct |
322 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43294803 |
caagtatgatactcaaaagcgaaattagtagtttttgtcttttaccacaaaaaagataggagtttaattttctctaacaaccattgtaactttgcttcct |
43294902 |
T |
|
| Q |
323 |
tgtgattgaaaatccgattattgctttcttttcaaatcacttagacacacgagaaccaaattaagagaaacaaagacgggatagattttgtcgatccagc |
422 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43294903 |
tgtgattgaaaatccgattattgctttcttttcaaatcacttagacacacgagaaccaaattaagagaaacaaagaccggatagattttgtcgatccagc |
43295002 |
T |
|
| Q |
423 |
caattg |
428 |
Q |
| |
|
|||||| |
|
|
| T |
43295003 |
caattg |
43295008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 9 - 99
Target Start/End: Original strand, 43294498 - 43294588
Alignment:
| Q |
9 |
ctaccactttagttatatacgaatcattcatacatatatcaagggttgtctttgttaatgtatgtatgtatgtatgggatatagggctaag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43294498 |
ctaccactttagttatatacgaatcattcatacatatatcaagggttgtctttgttaatgtatgtatgtatgtatgggatatagggctaag |
43294588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 158 - 194
Target Start/End: Original strand, 43294658 - 43294694
Alignment:
| Q |
158 |
atttattctaacatcttatgcctaacataacaagtgt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43294658 |
atttattctaacatcttatgcctaacataacaagtgt |
43294694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University