View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk444-LTR4-TNT-insertion-23 (Length: 106)
Name: Tnk444-LTR4-TNT-insertion-23
Description: Tnk444-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk444-LTR4-TNT-insertion-23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 38052621 - 38052704
Alignment:
| Q |
8 |
catagaacacttaaaactattaaaacaaccttacaaatgaaattctaatgaagtaaacatcaatattgaatgaaatttcacatc |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052621 |
catagaacacttaaaactattaaaacaaccttacaaatgaaattctaatgaagtaaacatcaatattgaatgaaatttcacatc |
38052704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University