View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk444-LTR4-TNT-insertion-6 (Length: 76)
Name: Tnk444-LTR4-TNT-insertion-6
Description: Tnk444-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk444-LTR4-TNT-insertion-6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 9 - 67
Target Start/End: Original strand, 33003639 - 33003697
Alignment:
| Q |
9 |
gtttcttctaaacaccaagtgtgctataaattagtttcaaatgtcaatatcatcaattg |
67 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33003639 |
gtttcttcaaaacaccaagtgtgccataaattagtttcaaatgtcaatatcatcaattg |
33003697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University