View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk444-LTR4-TNT-insertion-9 (Length: 295)
Name: Tnk444-LTR4-TNT-insertion-9
Description: Tnk444-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk444-LTR4-TNT-insertion-9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 8 - 264
Target Start/End: Complemental strand, 27764351 - 27764095
Alignment:
| Q |
8 |
gtaacctcgatatcagctatggcagctttggtctcggatgtgtatttgttaggtgtttgggaccatgtatattgaggatacacaaaaaattgtgcaaaag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27764351 |
gtaacctcgatatcagctatggcagctttggtcttggatgtgtatttgttaggtgtttgggaccatgtatattgaggatacacaaaaaattgtgcaaaag |
27764252 |
T |
 |
| Q |
108 |
gtggttttgatattgccatgtcttcattgtttcgtgttacttcttgttgtacaagttgtaactttctagcttcaagtgattgcaagagatgctctaactc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27764251 |
gtggttttgatattgccatgtcttcattgttttgtgttacttcttgttgtacaagttgtaactttctagcttcaagtgattgcaagagatgctctaactc |
27764152 |
T |
 |
| Q |
208 |
cttcacaaactctatggcaccacctactattgaggcttggacaccctataacaaaac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27764151 |
cttcacaaactctatggcaccacctactattgaggcttggtcaccctataacaaaac |
27764095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University