View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk450-LTR4-TNT-insertion-12 (Length: 137)
Name: Tnk450-LTR4-TNT-insertion-12
Description: Tnk450-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk450-LTR4-TNT-insertion-12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 5e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 29 - 128
Target Start/End: Complemental strand, 4523858 - 4523758
Alignment:
| Q |
29 |
ttgcatattttgtaaaatagtgagcagcttgattagcttctcttcaaacat-nnnnnnntaataaaaatgttcataatattttggcactcagcaacaatt |
127 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4523858 |
ttgcatattttgcaaaatagtgagcagcttgattagcttctcttctaacatgaaaaaaataataaaattgttcataatattttggcactcagcaacaatt |
4523759 |
T |
|
| Q |
128 |
g |
128 |
Q |
| |
|
| |
|
|
| T |
4523758 |
g |
4523758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 43 - 79
Target Start/End: Original strand, 19119715 - 19119751
Alignment:
| Q |
43 |
aaatagtgagcagcttgattagcttctcttcaaacat |
79 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19119715 |
aaatagtggccagcttgattagcttctcttcaaacat |
19119751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 43 - 79
Target Start/End: Complemental strand, 20782006 - 20781970
Alignment:
| Q |
43 |
aaatagtgagcagcttgattagcttctcttcaaacat |
79 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
20782006 |
aaataatgagcagcttgattagcttctcttctaacat |
20781970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University