View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-10-LTR4-TNT-insertion-4 (Length: 189)
Name: Tnk88-10-LTR4-TNT-insertion-4
Description: Tnk88-10-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-10-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 28694869 - 28694808
Alignment:
| Q |
118 |
ttcattccaattactcttgcttgttgatatgtgaacgacttttggtttaagctttcctatta |
179 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28694869 |
ttcattccaattactcttgcttattgatatgtgaacaacttttggtttaagctttcctatta |
28694808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 17 - 65
Target Start/End: Complemental strand, 28694914 - 28694866
Alignment:
| Q |
17 |
cttacttattgtgatccaaaattaagagtaaggaatactgattatttca |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28694914 |
cttacttattgtgatccaaaattaagagtaaggaatactgattatttca |
28694866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University