View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-16-LTR4-TNT-insertion-17 (Length: 149)
Name: Tnk88-16-LTR4-TNT-insertion-17
Description: Tnk88-16-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-16-LTR4-TNT-insertion-17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 4e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 4e-21
Query Start/End: Original strand, 67 - 122
Target Start/End: Original strand, 17371522 - 17371577
Alignment:
| Q |
67 |
tatgatgaacttttatgcgtgaaggatgaacaatttggggataaagaagaagatta |
122 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17371522 |
tatgatgaacttttatgggtgaaggatgaacaatttggggataaagaagaagatta |
17371577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 4e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 4e-21
Query Start/End: Original strand, 67 - 122
Target Start/End: Original strand, 24749272 - 24749327
Alignment:
| Q |
67 |
tatgatgaacttttatgcgtgaaggatgaacaatttggggataaagaagaagatta |
122 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24749272 |
tatgatgaacttttatgggtgaaggatgaacaatttggggataaagaagaagatta |
24749327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University