View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Tnk88-16-LTR4-TNT-insertion-17 (Length: 149)

Name: Tnk88-16-LTR4-TNT-insertion-17
Description: Tnk88-16-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Tnk88-16-LTR4-TNT-insertion-17
Tnk88-16-LTR4-TNT-insertion-17
[»] chr4 (1 HSPs)
chr4 (67-122)||(17371522-17371577)
[»] chr2 (1 HSPs)
chr2 (67-122)||(24749272-24749327)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 4e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 4e-21
Query Start/End: Original strand, 67 - 122
Target Start/End: Original strand, 17371522 - 17371577
Alignment:
67 tatgatgaacttttatgcgtgaaggatgaacaatttggggataaagaagaagatta 122  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
17371522 tatgatgaacttttatgggtgaaggatgaacaatttggggataaagaagaagatta 17371577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 52; Significance: 4e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 4e-21
Query Start/End: Original strand, 67 - 122
Target Start/End: Original strand, 24749272 - 24749327
Alignment:
67 tatgatgaacttttatgcgtgaaggatgaacaatttggggataaagaagaagatta 122  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
24749272 tatgatgaacttttatgggtgaaggatgaacaatttggggataaagaagaagatta 24749327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University