View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-16-LTR4-TNT-insertion-6 (Length: 259)
Name: Tnk88-16-LTR4-TNT-insertion-6
Description: Tnk88-16-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-16-LTR4-TNT-insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 33922997 - 33923239
Alignment:
| Q |
9 |
cagggttatagggagtgcaaatacagaaagcaccaccgtggatgtagatgaggagaggtagttttgtagaaggagtggcgtttggtgggagatagagacg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33922997 |
cagggttatagggagtgcaaatacagaaagcaccaccgtggatgtagatgaggagaggtaattttgtagaaggagtggcgtttggtgggagatagagacg |
33923096 |
T |
|
| Q |
109 |
agctccgatgccagtgttagggttgatggtgatgtctttggatataacgccggttaatggatcggtgccggttggggtggtttcagtgccgaggaagcgt |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33923097 |
agctccgatgccggtgttagggttgatggtgatgtctttggatataacgccggttaatggatcagtgccggttggggtggtttcggtgccgaggaagcgt |
33923196 |
T |
|
| Q |
209 |
tcgacgcggccgtctttgtactgacggaagaggcgagggaatt |
251 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33923197 |
tcgacgcggccgtctttgtactgacagaagaggcgagggaatt |
33923239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University