View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-26-LTR4-TNT-insertion-13 (Length: 409)
Name: Tnk88-26-LTR4-TNT-insertion-13
Description: Tnk88-26-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-26-LTR4-TNT-insertion-13 |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 8 - 309
Target Start/End: Complemental strand, 11119026 - 11118725
Alignment:
| Q |
8 |
ccagaatccattttcaaccttacaaacctaaatacactagatctatcatcaaacaacttgagtggtgctgtcaattttaaactcttctccaaatttgatg |
107 |
Q |
| |
|
||||||| |||||||| ||| ||||| ||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
11119026 |
ccagaatgcattttcagcctaacaaagctagatgaactagatctatcatcaaacaacttgagtggtgttgtcaattttaaactcttctccaaatttgctg |
11118927 |
T |
 |
| Q |
108 |
aactggaaattttatccctttcaaggaatagtcagttgtcactaaaattcgaatccaatgacacttatagttttactaacctacaaatactgaaattatc |
207 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11118926 |
acctggaaattttatccctttcaaggaatagtcagttgtcactaaaattcgaatccaatgtcacttatagttttactaacctacaaatactcaaattatc |
11118827 |
T |
 |
| Q |
208 |
ttctgtcatattgattgagtttcacaacttacaaggagatttcccacgtttgcaacatctgcatctttccaataacaaacttagtggaagaatgcccaat |
307 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||||| || ||| ||||| ||||||| |||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
11118826 |
ttctgtcaacttgatcgaatttcacaacttacaaggagaatttccaagtttgtcacatctggatctttccaaaaacaaacttaatggaagaatgcccaat |
11118727 |
T |
 |
| Q |
308 |
tg |
309 |
Q |
| |
|
|| |
|
|
| T |
11118726 |
tg |
11118725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 304 - 400
Target Start/End: Complemental strand, 22724682 - 22724586
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22724682 |
caattgcacaaacaaatctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctctgttttcctcccaaagattcaattg |
22724586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 304 - 389
Target Start/End: Original strand, 36038864 - 36038949
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36038864 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctctgttttcctcccaa |
36038949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 304 - 400
Target Start/End: Complemental strand, 41403939 - 41403842
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaa-tcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
41403939 |
caattgcacaaacaaagctacagcaaaaatcgatcccctcttgctcttgttctccccttggcttggttttctctgttttcttcccaaaggttcaattg |
41403842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 376
Target Start/End: Original strand, 15535175 - 15535247
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15535175 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
15535247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 376
Target Start/End: Complemental strand, 49546943 - 49546871
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49546943 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
49546871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 304 - 372
Target Start/End: Original strand, 14486719 - 14486787
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggtttt |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||| |
|
|
| T |
14486719 |
caattgcacaaacaaagctacagcaaaatcgatcccttcttgctcttgctctccccttggcttggtttt |
14486787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 93; Significance: 4e-45; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 304 - 400
Target Start/End: Original strand, 364919 - 365015
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
364919 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctctgttttcctcccaaagtttcaattg |
365015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 304 - 376
Target Start/End: Complemental strand, 8727729 - 8727658
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
8727729 |
caattgcacaa-caaagctacagcaaaatcgatcccctcttgctcttgttctccccttggctttgttttctct |
8727658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 309 - 372
Target Start/End: Complemental strand, 29643371 - 29643308
Alignment:
| Q |
309 |
gcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggtttt |
372 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
29643371 |
gcacgaacaaagctacaataaaatcgatcccctcttgctcttgctctccccttggctttgtttt |
29643308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 89; Significance: 9e-43; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 304 - 400
Target Start/End: Original strand, 12306116 - 12306212
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12306116 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctctgttttcctcccagagtttcaattg |
12306212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 304 - 400
Target Start/End: Complemental strand, 29544032 - 29543936
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29544032 |
caattgcacaaacaaaactacagcaaaatcgatcccctcttgctcttgttctctccttggcttggttttctctgttttcctcccaaagtttcaattg |
29543936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 304 - 400
Target Start/End: Complemental strand, 46722585 - 46722489
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46722585 |
caattgcacaaacaaagctacagcaaaatcgttcccctcttgctcttgttctacctttggcttggttttctctgttttcctcccaaaagttcaattg |
46722489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 376
Target Start/End: Complemental strand, 38310796 - 38310724
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38310796 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
38310724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 376
Target Start/End: Original strand, 54521816 - 54521888
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54521816 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
54521888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 304 - 399
Target Start/End: Complemental strand, 8373090 - 8372994
Alignment:
| Q |
304 |
caattgcacaa-acaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaatt |
399 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| || ||||||| ||||| ||||||| |
|
|
| T |
8373090 |
caattgcacaacacaaagctacagcaaaattgatcccctcttgctcttgttctccccttggcttggttttctttgctttcctctcaaaggttcaatt |
8372994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 304 - 376
Target Start/End: Original strand, 16801087 - 16801159
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16801087 |
caattgcacaaacaaagctacaacaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
16801159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 304 - 376
Target Start/End: Complemental strand, 20247785 - 20247713
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20247785 |
caattgcacaaacgaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
20247713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 304 - 372
Target Start/End: Original strand, 24193016 - 24193084
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggtttt |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24193016 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggtttt |
24193084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 8523917 - 8523841
Alignment:
| Q |
8 |
ccagaatccattttcaaccttacaaacctaaatacactagatctatcatcaaacaacttgagtggtgctgtcaattt |
84 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8523917 |
ccagaatccattttcaaccttgcaaacctaagtagactagatctatcatcaaacaacttgagtggtgttgtcaattt |
8523841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 78; Significance: 3e-36; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 304 - 400
Target Start/End: Complemental strand, 13100733 - 13100634
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttct---gcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13100733 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctcccccccttggcttggttttctttgttttcctcccaaagtttcaattg |
13100634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 304 - 400
Target Start/End: Original strand, 45029400 - 45029497
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaa-tcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45029400 |
caattgcacaaataaagctacagcaaaaatcgaccccctcttgctcttgttctcctcttggcttggttttctctgttttcctcccaaaggttcaattg |
45029497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 376
Target Start/End: Complemental strand, 10683931 - 10683859
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10683931 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
10683859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 304 - 376
Target Start/End: Original strand, 20262213 - 20262285
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20262213 |
caattgcacaaacaaagctacaacaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
20262285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 12 - 100
Target Start/End: Complemental strand, 12249357 - 12249269
Alignment:
| Q |
12 |
aatccattttcaaccttacaaacctaaatacactagatctatcatcaaacaacttgagtggtgctgtcaattttaaactcttctccaaa |
100 |
Q |
| |
|
||||||||||||||||||||| ||||| || ||||||| |||||||||||||||||||||||| ||| ||||| ||||||| |||||| |
|
|
| T |
12249357 |
aatccattttcaaccttacaaccctaactagactagatttatcatcaaacaacttgagtggtgttgttgattttcaactcttttccaaa |
12249269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 120 - 211
Target Start/End: Original strand, 32681369 - 32681460
Alignment:
| Q |
120 |
tatccctttcaaggaatagtcagttgtcactaaaattcgaatccaatgacacttatagttttactaacctacaaatactgaaattatcttct |
211 |
Q |
| |
|
|||| |||||| |||||||||| ||||||||||| || |||||||||| || ||||| |||| || ||||||||| | || |||| |||||| |
|
|
| T |
32681369 |
tatctctttcatggaatagtcaattgtcactaaactttgaatccaatgtcagttatacttttccttacctacaaacattggaattgtcttct |
32681460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 77; Significance: 1e-35; HSPs: 14)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 304 - 400
Target Start/End: Complemental strand, 24594063 - 24593967
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24594063 |
caattgcacaaacaaagctacagcaaaatcgttcccctcttgctcttgttctccctttggcttggttttctctgttttcctcccaaaagttcaattg |
24593967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 304 - 400
Target Start/End: Complemental strand, 24668157 - 24668061
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
24668157 |
caattgcacaaacaaagctacagcaaaatcgttcccctcttgctcttgttctccctttggcttggttttttctgttttcctcccaaaagttcaattg |
24668061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 304 - 400
Target Start/End: Complemental strand, 24736752 - 24736656
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
24736752 |
caattgcacaaacaaagctacagcaaaatcgttcccctcttgctcttgttctccctttggcttggttttttctgttttcctcccaaaagttcaattg |
24736656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 304 - 400
Target Start/End: Complemental strand, 24737926 - 24737830
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
24737926 |
caattgcacaaacaaagctacagcaaaatcgttcccctcttgctcttgttctccctttggcttggttttttctgttttcctcccaaaagttcaattg |
24737830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 304 - 400
Target Start/End: Complemental strand, 24750695 - 24750599
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctctgttttcctcccaaagtttcaattg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
24750695 |
caattgcacaaacaaagctacagcaaaatcgttcccctcttgctcttgttctccctttggcttggttttttctgttttcctcccaaaagttcaattg |
24750599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 376
Target Start/End: Original strand, 9777159 - 9777231
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9777159 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
9777231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 49 - 215
Target Start/End: Complemental strand, 42124346 - 42124180
Alignment:
| Q |
49 |
tctatcatcaaacaacttgagtggtgctgtcaattttaaactcttctccaaatttg-atgaactggaaattttatccctttcaaggaatagtcagttgtc |
147 |
Q |
| |
|
|||||| || ||| ||||||||||| |||||||||| |||||||||||||| || ||| || ||||| |||||||||||| |||||||||| || || |
|
|
| T |
42124346 |
tctatcttcgaacgacttgagtggtcttgtcaattttcaactcttctccaaacttacatgt-ctagaaatgttatccctttcatggaatagtcaattatc |
42124248 |
T |
 |
| Q |
148 |
actaaaattcgaatccaatgacacttatagttttactaacctacaaatactgaaattatcttctgtca |
215 |
Q |
| |
|
||||| || |||||||||| || |||||||||| ||| ||||||| || || |||| |||||||||| |
|
|
| T |
42124247 |
tctaaattttgaatccaatgtcaattatagtttttctagcctacaagtattggaattgtcttctgtca |
42124180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 17 - 85
Target Start/End: Original strand, 34239782 - 34239850
Alignment:
| Q |
17 |
attttcaaccttacaaacctaaatacactagatctatcatcaaacaacttgagtggtgctgtcaatttt |
85 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34239782 |
attttcaaccttgcaaacctaattacactatgtctatcatcaaacaacttgagtggtgttgtcaatttt |
34239850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 8 - 74
Target Start/End: Original strand, 41712767 - 41712833
Alignment:
| Q |
8 |
ccagaatccattttcaaccttacaaacctaaatacactagatctatcatcaaacaacttgagtggtg |
74 |
Q |
| |
|
|||||||| |||||||| |||| |||||||| || |||||| ||||||||||||||||| ||||||| |
|
|
| T |
41712767 |
ccagaatcaattttcaaacttataaacctaactagactagacctatcatcaaacaacttcagtggtg |
41712833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 88
Target Start/End: Original strand, 41571229 - 41571306
Alignment:
| Q |
11 |
gaatccattttcaaccttacaaacctaaatacactagatctatcatcaaacaacttgagtggtgctgtcaattttaaa |
88 |
Q |
| |
|
||||| |||||||||||| |||||||| ||||||| || ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41571229 |
gaatctattttcaaccttgtaaacctaactacactatgcctgtcatcaaacaacttgagtggtattgtcaattttaaa |
41571306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 45 - 85
Target Start/End: Original strand, 34232058 - 34232098
Alignment:
| Q |
45 |
tagatctatcatcaaacaacttgagtggtgctgtcaatttt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34232058 |
tagatctatcatcaaacaacttgagtggtgttgtcaatttt |
34232098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 49 - 96
Target Start/End: Complemental strand, 41445195 - 41445148
Alignment:
| Q |
49 |
tctatcatcaaacaacttgagtggtgctgtcaattttaaactcttctc |
96 |
Q |
| |
|
|||||| ||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
41445195 |
tctatcttcaaataacttgagtggttttgtcaattttaaactcttctc |
41445148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 42129758 - 42129699
Alignment:
| Q |
12 |
aatccattttcaaccttacaaacctaaatacactagatctatcatcaaacaacttgagtg |
71 |
Q |
| |
|
|||| |||||||||||| ||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
42129758 |
aatctattttcaaccttgcaaacttaactttgctagatctatcatcaaacaacttgagtg |
42129699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 41432384 - 41432340
Alignment:
| Q |
49 |
tctatcatcaaacaacttgagtggtgctgtcaattttaaactctt |
93 |
Q |
| |
|
|||||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
41432384 |
tctatcttcaaataacttgagtggttttgtcaattttaaactctt |
41432340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 8e-31; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 376
Target Start/End: Complemental strand, 23664121 - 23664049
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23664121 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
23664049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 376
Target Start/End: Original strand, 29797605 - 29797677
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29797605 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
29797677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 376
Target Start/End: Original strand, 29801424 - 29801496
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29801424 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
29801496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 10895787 - 10895742
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctct |
349 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10895787 |
caattgcccaaacaaagctacagcaaaatcgatcctctcttgctct |
10895742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 16009635 - 16009680
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctct |
349 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16009635 |
caattgcccaaacaaagctacagcaaaatcgatcctctcttgctct |
16009680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 376
Target Start/End: Original strand, 11304281 - 11304315
Alignment:
| Q |
342 |
cttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
11304281 |
cttgctcttgttctccccttggcttggttttctct |
11304315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 8e-31; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 376
Target Start/End: Complemental strand, 2286763 - 2286691
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2286763 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
2286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 304 - 376
Target Start/End: Complemental strand, 29483427 - 29483355
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggttttctct |
376 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29483427 |
caattgcacaaataaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggttttctct |
29483355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 8 - 167
Target Start/End: Original strand, 25522238 - 25522397
Alignment:
| Q |
8 |
ccagaatccattttcaaccttacaaacctaaatacactagatctatcatcaaacaacttgagtggtgctgtcaattttaaactcttctccaaatttgatg |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || ||| |||||| | |||| ||||||||||| |||||||||| ||| ||| |||||| || |
|
|
| T |
25522238 |
ccagaatccattttcaatcttacaaacctaactaatctaattctatctttaaacgacttgagtggttttgtcaattttcaacacttttccaaacttacaa |
25522337 |
T |
 |
| Q |
108 |
aactggaaattttatccctttcaaggaatagtcagttgtcactaaaattcgaatccaatg |
167 |
Q |
| |
|
| || | |||||||||||||| |||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
25522338 |
atcttcgatttttatccctttcatggaatactcaattgtcactaaacttcgaatccaatg |
25522397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 304 - 348
Target Start/End: Original strand, 25598703 - 25598747
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctc |
348 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25598703 |
caattgcacaaagaaagctacagcaaaatcgatcccctcttgctc |
25598747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 4477916 - 4477961
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctct |
349 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4477916 |
caattgcccaaacaaagctacagcaaaatcgatcctctcttgctct |
4477961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 270 - 309
Target Start/End: Original strand, 25522500 - 25522539
Alignment:
| Q |
270 |
atctttccaataacaaacttagtggaagaatgcccaattg |
309 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25522500 |
atctttccaataacaaacttgatggaagaatgcccaattg |
25522539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 304 - 372
Target Start/End: Complemental strand, 14391 - 14323
Alignment:
| Q |
304 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctgcccttggcttggtttt |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14391 |
caattgcacaaacaaagctacagcaaaatcgatcccctcttgctcttgttctccccttggcttggtttt |
14323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University