View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-28-LTR4-TNT-insertion-10 (Length: 235)
Name: Tnk88-28-LTR4-TNT-insertion-10
Description: Tnk88-28-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-28-LTR4-TNT-insertion-10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 112 - 226
Target Start/End: Original strand, 51196732 - 51196849
Alignment:
| Q |
112 |
ttcaacttgcgggccaagcaaatatgc---atacgtagtttcgaatttatctactatataagatagtatgaacaaaacatgttacataagttggcaacca |
208 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
51196732 |
ttcaacttgcgggccaagcaaatatgctgcatacgtagtttcgaatttatctactatataagatagtatgaacaagacatgttacttaagttggcaacca |
51196831 |
T |
|
| Q |
209 |
ttttctaactaacaattg |
226 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
51196832 |
ttttctaactaacaattg |
51196849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 51196685 - 51196739
Alignment:
| Q |
8 |
gatctatgactgatccaagataacataattgaaaaaaggtagtatagtttaactt |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51196685 |
gatctatgactgatccaagataacataattgaaaaaaggtagtatagttcaactt |
51196739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University