View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-28-LTR4-TNT-insertion-2 (Length: 135)
Name: Tnk88-28-LTR4-TNT-insertion-2
Description: Tnk88-28-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-28-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 5e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 11 - 126
Target Start/End: Original strand, 27065913 - 27066028
Alignment:
| Q |
11 |
gatcaattcaccaagaatttcaagccggaaaattcaaacacatggccggaaaagcacgtcttccaccatcatttcggctggcaaccggagaagtctttcg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27065913 |
gatcaattcaccaagaatttcaagccggaaaattcaaacacatggccggaaaagcacgtcttccaccatcatttcggctggcaaccggagaagtctttcc |
27066012 |
T |
|
| Q |
111 |
gatagttttgcaattg |
126 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27066013 |
gatagttttgcaattg |
27066028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 11 - 126
Target Start/End: Complemental strand, 27212400 - 27212285
Alignment:
| Q |
11 |
gatcaattcaccaagaatttcaagccggaaaattcaaacacatggccggaaaagcacgtcttccaccatcatttcggctggcaaccggagaagtctttcg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27212400 |
gatcaattcaccaagaatttcaagccggaaaattcaaacacatggccggaaaagcacgtcttccaccatcatttcggctggcaaccggagaagtctttcc |
27212301 |
T |
|
| Q |
111 |
gatagttttgcaattg |
126 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27212300 |
gatagttttgcaattg |
27212285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University