View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Tnk88-28-LTR4-TNT-insertion-2 (Length: 135)

Name: Tnk88-28-LTR4-TNT-insertion-2
Description: Tnk88-28-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Tnk88-28-LTR4-TNT-insertion-2
Tnk88-28-LTR4-TNT-insertion-2
[»] chr7 (2 HSPs)
chr7 (11-126)||(27065913-27066028)
chr7 (11-126)||(27212285-27212400)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 5e-57; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 11 - 126
Target Start/End: Original strand, 27065913 - 27066028
Alignment:
11 gatcaattcaccaagaatttcaagccggaaaattcaaacacatggccggaaaagcacgtcttccaccatcatttcggctggcaaccggagaagtctttcg 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
27065913 gatcaattcaccaagaatttcaagccggaaaattcaaacacatggccggaaaagcacgtcttccaccatcatttcggctggcaaccggagaagtctttcc 27066012  T
111 gatagttttgcaattg 126  Q
    ||||||||||||||||    
27066013 gatagttttgcaattg 27066028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 11 - 126
Target Start/End: Complemental strand, 27212400 - 27212285
Alignment:
11 gatcaattcaccaagaatttcaagccggaaaattcaaacacatggccggaaaagcacgtcttccaccatcatttcggctggcaaccggagaagtctttcg 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
27212400 gatcaattcaccaagaatttcaagccggaaaattcaaacacatggccggaaaagcacgtcttccaccatcatttcggctggcaaccggagaagtctttcc 27212301  T
111 gatagttttgcaattg 126  Q
    ||||||||||||||||    
27212300 gatagttttgcaattg 27212285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University