View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-28-LTR4-TNT-insertion-3 (Length: 102)
Name: Tnk88-28-LTR4-TNT-insertion-3
Description: Tnk88-28-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-28-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 2e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 9 - 95
Target Start/End: Complemental strand, 7950672 - 7950586
Alignment:
| Q |
9 |
tatctacttttttatatttaacgagtcctatttatacacatcgttctaattttcattatatctcgtcttgtaagtgtagctcaattg |
95 |
Q |
| |
|
|||||||| ||||||| ||||||| || |||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||| |
|
|
| T |
7950672 |
tatctactattttatacttaacgattcttatttatacacatcgttctaattttcattatatctcatcttgtaagtgtaacttaattg |
7950586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University