View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-28-LTR4-TNT-insertion-6 (Length: 86)
Name: Tnk88-28-LTR4-TNT-insertion-6
Description: Tnk88-28-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-28-LTR4-TNT-insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 9 - 78
Target Start/End: Original strand, 40113422 - 40113491
Alignment:
| Q |
9 |
tagtgaggtgtccccatgttcttgagagagaaagttttagataaagattgaatgaagttgtgtaggaatt |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113422 |
tagtgaggtgtccccatgttcttgagagagaaagttttagataaagattgaatgaagttgtgtaggaatt |
40113491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 70; Significance: 3e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 6406811 - 6406742
Alignment:
| Q |
9 |
tagtgaggtgtccccatgttcttgagagagaaagttttagataaagattgaatgaagttgtgtaggaatt |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6406811 |
tagtgaggtgtccccatgttcttgagagagaaagttttagataaagattgaatgaagttgtgtaggaatt |
6406742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University